If #cas9 were a candy it would be a #jellybean #molbiocandy

1 week out from #ASGCT24 y'all! If this is your 1st time or you don't know many folks, don't worry b/c you know me. Come say hi & that you know me from Twitter & I'll invite you to stuff + plug you into the scene. Don't be nervous, you've already got 1 #GeneTherapy friend 👋

We are excited to announce the launch of Twist Multiplexed Gene Fragments! Pools of double-stranded DNA up to 500 base pairs in length with no limit on sequence number to enable high throughput screening applications. Details here 👉 tinyurl.com/5x7ukw97 Twist Bioscience

New preprint describing our effort to minimise the size of genome-wide CRISPR-Cas9 libraries. Check it out: biorxiv.org/cgi/content/sh…

Did you hear our big news? We just launched Twist Multiplexed Gene Fragments! Pools of double-stranded DNA up to 500 base pairs in length with no limit on sequence number to enable high throughput screening applications. Details 👉 bit.ly/4bMHwLB bit.ly/4bLeX1h

I have found Dr. Eaton to be exceptional at explaining the AI/CRISPR Venn diagram and recommend this highly.

Delighted to co-lead the $142M seed round in EvolutionaryScale with Nat Friedman Daniel Gross Lux Capital, a new frontier AI lab that has now trained ESM3, a natively multimodal and generative language model for proteins and the largest biological language model to date

We aim to provide useful computational tools so folks can hit the ground running with bridge recombinases! Bridge RNAs are a bit more complicated than CRISPR guides, so here's a simple bridge RNA guide designer, your feedback is welcome: bridge.hsulab.arcinstitute.org

Please RT! Brian Hie and I are hiring joint Arc Institute postdocs to work on ML in biology. Projects include reimagining synthetic gene circuits, mechanistic interpretability, and controllability. Recent work includes genome design with Evo, an AI foundation model trained on DNA

After all this time there is a huge resemblance between the crypto market and the nuclease market. There is #Cas9 #Cas12a and then a lot of other Xases just like BTC, ETH and a ton of memecoins. Dominance outweighs performance

TCGA GTCGAC TAACTATAACGGTCGGGAAGTAGCC AGCT CCTNAGG TCGAT GTNNAC GCGC GCGC CCANNNNNTGG GTNNAC AGGCCT ATTA CCTCGAG

See you tomorrow #EpiBio2024! Twist Bioscience will be @ the 7th Intl. Conference on Epigenetics & Bioengineering. 👋 Meet Jude & Lieke at our booth where we’ll be showcasing our cutting-edge tools, including our newest innovation— Multiplexed Gene Fragments. American Institute of Chemical Engineers (AIChE)

Check out our bioRxiv describing our efforts to treat a severe vascular disease 🫀: 1️⃣ Optimization of a target-specific base editor🧬 2⃣ A *must avoid* bystander edit prevalent with WT SpCas9 BEs! 🙅‍♂️😱 3⃣ Substantial extension of lifespan following in vivo base

FutureHouse is launching an independent postdoctoral fellowship program for exceptional researchers who want to apply our automated science tools to specific problems in biology and biochemistry, in collaboration with world-leading academic labs. --$125,000 annual stipend.

Julian Jude on Synthesizing a New Era in Functional Genomics Jude, Twist Bioscience, American Institute of Chemical Engineers (AIChE) aiche.org/chenected/2025…

Apropos many people having their PhD / postdoc offers revoked in the past few weeks - we are hiring for Scientist & Research associate roles! In this role you will be: - Writing operating system of the cells - Blessing immortalized cells with transfection reagents -

In @nature we describe the use of scalable #proteinengineering & #machinelearning to predict millions of bespoke CRISPR-Cas9 enzymes, offering safer & more genome editing tools. 🧬🖥️ Rachel Silverstein CGM at MGH @MGH_RI MassGeneral News Harvard Medical School nature.com/articles/s4158…

I got hit by some rather sudden and extreme financial hardship so if anyone is in need of remote wetlab contract research, strictly BSL1, do let me know. Currently scrambling for gigs. Plant, Bacterial, Archaeal Bioeng Custom Lab Hardware Turn Key Genetic Design Please RT 💚

If you're passionate about building the world's first AI virtual cell model, we're hiring at XairaTherapeutics-- come join us! job-boards.greenhouse.io/xairatherapeut…

Cells are dynamic, messy and context dependent. Scaling models across diverse states needs flexibility to capture heterogeneity Introducing State, a transformer that predicts perturbation effects by training over sets of cells Team effort led by the unstoppable Abhinav Adduri