Check out our latest review in Trends in Genetics where we compare timescales of transcription regulatory steps (input) and transcriptional burst kinetics (output) to better understand the mechanisms of transcription regulation. doi.org/10.1016/j.tig.…

Pinpointing causal variants that disrupt development. So proud of the amazing team on this epic enhancer genotype-to-phenotype study. Well Done, Fabian Lim, Joe Solvason, Genevieve Ryan, Sophia Le, Granton Jindal, Paige Steffen and Simran Jandu!!! doi.org/10.1038/s41586…

Presenting in lab meeting when you don't have new data x.com/Xudong1966/sta…

Ever used a FLAG-tag and wondered how it is recognized by anti-FLAG M2? Check out our preprint where we determined a 💎crystal💎 structure of the complex: biorxiv.org/content/10.110… (FLAG peptide in pink in the video below) #structuralbiology #crystallography

Excited to share that my first postdoc paper is now online! 🎉 We explore the dynamics of RNA polymerase II in yeast using single-molecule tracking to understand how it searches for genes within the nucleus. Check it out: nature.com/articles/s4155…

AATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAGAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAAAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTGA

Just updated! We updated our massive database of funding opportunities for POSTDOC fellowships. Each entry (316!), we provide the $ amount, deadline, eligibility criteria, description, and link to funder. Download this database freely here: research.jhu.edu/rdt/funding-op…

Look at that Heme!!!!!

Just updated! Download our database of 190 PhD fellowships. For each entry, we provide a description of the fellowship, link, amount, eligibility criteria, and deadline. Download it here (free): research.jhu.edu/rdt/funding-op…

Online Now: Time-resolved profiling of RNA binding proteins throughout the mRNA life cycle dlvr.it/T5GfWv

We joke that DMEM is fancy Gatorade.... So how much DMEM can you replace with Gatorade before cells die? Lets find out!

Join us on Friday, June 21 for a symposium exploring patient-specific variation in cancer progression and response to therapy. Our exciting lineup of speakers starts with keynote @‌CedricBlanpain. Register: eventbrite.com/e/tumor-hetero…

I think my protein loves me 🖤

HHMI lab at public university

Van Gogh's paintings can come to life thanks to AI.

Professors when you need their signature

What beautiful structures 🤗👏: Structures of H2A.Z-associated human chromatin remodelers SRCAP and TIP60 reveal divergent mechanisms of chromatin engagement biorxiv.org/content/10.110…

It’s just a tiny bottle.. It probably doesn’t smell that bad Tiny Bottle:

A tour de force from Carl Wu's lab Johns Hopkins University .- lead author postdoc Robert Louder: Molecular basis of global promoter sensing and nucleosome capture by t... sciencedirect.com/science/articl…