Check out our paper just published in OrphanetJournal at BMC. Major points: 1) Inborn errors of metabolism make up 27% of UDN diagnoses 2) Genome sequencing is a powerful tool in these diagnostic mysteries. Shout out to the Brilliant First author Dr. Furuta. ojrd.biomedcentral.com/articles/10.11…

UK Biobank to be further enriched with epigenetic data for 50,000 participants❗️ #deepest #phenotyped #cohort #in #history🧬 🔗nanoporetech.com/news/oxford-na…

This is a really fascinating and important paper, on the mechanism of neurodegeneration in Huntington's disease. I often think single-cell 'omics is an overhyped approach, but it was completely essential here. 1/

So SO excited to share that our latest work—most of my PhD(!)—is now published in Science Magazine ! 🎉🐶 Our study on #Labradors reveals key #genetics behind #obesity, with insights for both dogs & humans. Huge thanks to our collaborators & the amazing dogs + owners! 🦮

Too many people take biomedical innovation for granted.

Analyses leveraging large population datasets suggest potential undiagnosed patients with intermediate/mild phenotypes of PEX1-mediated #ZellwegerSpectrumDisorder and regional differences in variant landscape bit.ly/3FusVdh #GIMO #PopulationGenetics #PEX1

Out with the old? #OGM outperforms #CMA by revealing structural info, aiding clinical interpretation of copy number gains. bit.ly/3ZjYQ75 #VUS #genomicstructure

New from our team in AJO: The eye is a powerful window into undiagnosed genetic disease. Routine ophthalmic findings can reveal inherited conditions before systemic signs appear. ajo.com/article/S0002-… #EyeGenetics #RareDisease #GenomicMedicine

In our new paper, we solved a decades-long diagnostic mystery. Exome: no answer. Genome: no answer. PacBio HiFi revealed a giant MARCHF6 repeat expansion causing FAME3, with mosaicism seen at single-read resolution. link.springer.com/article/10.100… #FAME3 #Neurogenetics

New cohort study led by Cathy Shyr with our UDN team shows GPT-4o correctly suggested the final diagnosis in 13.3% of undiagnosed rare disease cases and gave a helpful differential in 23.3%. A promising step for LLMs in rare disease dx. #RareDisease jamanetwork.com/journals/jaman…

This is genuinely paradigm-shifting 1-3% of patients diagnosed with (relatively) common diseases – atopic dermatitis, inflammatory bowel disease, and multiple sclerosis – actually have much rarer monogenic conditions, revealed by genome sequencing Given the obvious importance

Our new paper (led by Yutaka Furata) shows CHD8-associated IDDAM can be inherited, not just de novo. Genome sequencing, EpiSign, and structural modeling enabled reclassification of a CHD8 VUS as pathogenic. onlinelibrary.wiley.com/doi/10.1002/mg… #RareDisease #Genomics #CHD8 #EpiSign

From all of us at Ensembl, we wish you holidays filled with "ATGGAACGCCGCATTATGGAAAACACCGCGAACGATCCGGAAGCGTGCGAA" May your celebrations be as perfectly in‑frame as your favourite gene.

As a doctor who treated patients for decades, my top priority is protecting children and families. Multiple children have died or were hospitalized from measles, and South Carolina continues to face a growing outbreak. Two children have died in my state from whooping cough. All

Pregnancy is usually safe… but risk isn’t one-size-fits-all.” Our paper links 58k+ mother–baby EHR dyads to map Mendelian condition-specific risks and build the largest dataset for personalized prenatal care. gimjournal.org/article/S1098-…

Hot take: What makes NYC so beautiful in the snow is that cars (and noise) virtually disappear.

Physicians who sit at the bedside (compared to standing) are perceived to have spent longer with their patient and have higher patient satisfaction.

I don't get the frustration people are venting over this. NG have gone out of their way to ensure that me and my students are not harmed by the increasing time lag between receiving our papers to accepting them by always (100% of the time!) rejecting my papers. 🙏

The 23&me GLP1 gwas paper is very well done (the most readable gwas paper ... ever?), but I think putting this supp table 22 result in the main text would have helped keep things in perspective