i smile at the "first to be a lesbian/trans/bi in my bloodline" but have you thought that you're 100% not the first, but maybe just the first to be free to be so?

And now 🌹Germaine🥀 I couldn’t decide if I liked cape or no cape so have both :) What story of evil character should I do next? #evilliouschronicles

twit2 cenblu yg hobi bentrokin cewek & cowok ada baiknya kgk usah di respon soalnya cuman cari engagement dan bikin bentrok doang. 2026 kok masi mempermasalahkan yg kek gitu dah kocyak 🙃

🥩❤️🥩

Ada cara blokir akun cenblu ga

new animal idea: ATGCGATATGCGCGATGCGATAGCGACAC, it wiggles around a little and dies

ok guys im logging off this acc for a while. see ya in my rp accs tho

For Kayo, I wanted to incorporate some of her history with Kai into her outfit, and also fish elements because of her connection to Rahab. Just a disclaimer: I found the vector pattern elements on Freepik and then modified them slightly. #evilliouschronicles

I must say i really do like how milgram draws eyes

Wibu indo pasca covid isinya mantan tukang bully wibu yg ngelarping jadi wibu dan sampe sekarang masih hobi ngebully wibu wibu yg dulu mereka bully.

Let's strike each other down with only our best tricks and specialties #02_m

GB MASUK NEWS!!!!!

i saw this and created this

ragebaiting crazy style

the facade is fading. #07_m #MILGRAM_fa