We have just updated our database of funding opportunities/fellowships for PhD students For each entry of the 190 entries, we provide link, $ amount, deadline, eligibility criteria (e.g. citizenship). Download this database for free here: research.jhu.edu/rdt/funding-op… Good luck!

Anyone in the NYC area who wants to be out and about looking for ticks, mice, birds, and other field work opportunities this summer? The Ecoepidemiology Lab is looking for numerous seasonal research assistants! You can apply here: tinyurl.com/y2e6acp6 Please RT!

Applications are open! Please RT

AATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAGAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAAAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTGA

These are my 5 top takeaways from the ElowitzLab interview that we published today. 1. Elowitz made one of the first synthetic gene circuits, called the repressilator. His publication helped establish synthetic biology. But he originally called the circuit the "oscillon"!🧵

It’s here! 👀 Light Bio

.UF IFAS Solutions' Dr. Rob Ferl will be the first NASA-funded academic researcher to conduct an experiment as a crew member on Blue Origin's upcoming #NewShepard mission. His journey will pave the way for more science experiments — and Gators — in space. 🚀 🌱 news.ufl.edu/2024/04/ferl-b…

Excited to share that I have been selected for the 2024 iteration of Cold Spring Harbor Laboratory Meetings and Courses in Synthetic Biology this summer. I am so fortunate to have the opportunity to learn cutting edge techniques from experts in the field and share ideas with my peers. CSHL Meetings 🧬⚙️

“DNA data storage isn’t far away. At Twist, we’ve completed proof of concept studies, including storing a series called Biohackers in DNA for Netflix. We’re planning to launch early access of our terabyte storage solution in 2025.” Emily Leproust OODA bit.ly/3WhQV9u

Intel's Pentium processor (1993) was a big jump in processor performance, starting a brand that lasted until 2023. But what's inside the Pentium chip? How did Intel organize its 3.3 million transistors? Let's take a look inside and see the chip's "standard cells". 1/21

DNA data storage fans, check out this article by Nina Notman in Chemistry World! DNA offers a compact, durable & low maintenance way to store our precious memories Twist Bioscience Emily Leproust @DNADataStorage @LuisCeze Karin Strauss @Robert_Grass SNIA bit.ly/3W8zS8j

Today we report in J. Am. Chem. Soc. a novel and highly modular platform for mechanically triggered chemiluminescence (bright light emission) from polymers. Congrats to Peng Liu｜刘朋, Yu-Ling (Debbie), and coworkers! Collab with Shabat Group. Caltech Chemistry & Chemical Engineering Caltech pubs.acs.org/doi/10.1021/ja…

30 Essays to Make You Love Biology Day 2. "Cells are very fast and crowded places" by Ken Shirriff. "A small molecule such as glucose is cruising around a cell at about 250 miles per hour." "A typical enzyme can collide with something to react with 500,000 times every second."

Save the Date! UF Chemistry-Biology Interface Mini Symposium on Nov 9, 2024. Join us for a day of research and networking!

when my cloning works on the fifth try

A great opportunity! If you are interested in marine microbes (coral-associated or otherwise) and natural products chemistry for your postdoc then Wendy_Strangman and I would be interested in chatting! lnkd.in/e3K3ZQGu

Imagine bacteria mining cryptocurrencies. We moved a step closer by encoding a 2-bit MD5 cryptographic hash algorithm – a precursor of SH256 used for Bitcoin - across 66 E. coli strains. It required over 1 megabase of DNA, the size of a small genome. nature.com/articles/s4158…

Biblically accurate protein interaction network

Dear friends who write NSF GRFP rec letters, this year rec letters are due BEFORE the applications, so about 10 days earlier than normal on Oct. 11. Please don't let NSF's deadline change on rec letters screw over the applicants in your lives.