Dan Thoresen (@dantlovestorun) 's Twitter Profile
Dan Thoresen

@dantlovestorun

Current PhD student researching host-virus interactions in Yale MCDB. Formerly Lawrence University. He/him.

ID: 992264760

calendar_today06-12-2012 03:07:39

332 Tweet

80 Takipçi

415 Takip Edilen

Dan Thoresen (@dantlovestorun) 's Twitter Profile Photo

As much as I love reading Ever Given memes and jokes, you have to figure that all these ships heading around Africa must be adding an enormous amount of CO2 to the atmosphere. Like, gigatons worth!

Dan Thoresen (@dantlovestorun) 's Twitter Profile Photo

So excited for #USATF at the olympics! ahttps://www.nytimes.com/interactive/2021/07/30/sports/olympics/olympic-running.html?smid=tw-share

Journal of Experimental Medicine (@jexpmed) 's Twitter Profile Photo

This study by Tianyang Mao et al. @virusesimmunity team shows that RIG-I agonist stem loop RNA (SLR) triggers potent antiviral defense against #SARSCoV2 to prevent primary infection and clear chronic infection. bit.ly/3wwnlhP #COVID19 #InfectiousDisease #HostDefense

This study by <a href="/tianyangmao/">Tianyang Mao</a> et al. @virusesimmunity team shows that RIG-I agonist stem loop RNA (SLR) triggers potent antiviral defense against #SARSCoV2 to prevent primary infection and clear chronic infection. bit.ly/3wwnlhP

#COVID19 #InfectiousDisease #HostDefense
Twist Bioscience (@twistbioscience) 's Twitter Profile Photo

AATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAGAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAAAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTGA