🔥The 9th Round of Easy Loan, Earn $40 Reward is in progress❗️ ⏰ Promotion Period: January 15th - Feburary 15th, 2025 👉 Register now and check more details at gate.io/campaigns/358

Using cold-shipped boxes from lab to wrap Christmas gifts like a nerd....where do people get boxes for presents anyway?

Feeling uptight all week long like

I'm sorry, is this not a real word?? #spellingbee

How it started / how it's going Bunny + yogurt edition

Me working on manuscript...

If you want to make six figures overnight have you ever tried being a grad student???

As much as I love reading Ever Given memes and jokes, you have to figure that all these ships heading around Africa must be adding an enormous amount of CO2 to the atmosphere. Like, gigatons worth!

God bless Khris Middleton

So excited for #USATF at the olympics! ahttps://www.nytimes.com/interactive/2021/07/30/sports/olympics/olympic-running.html?smid=tw-share

This morning’s NYT crossword

6th year phd student

This study by Tianyang Mao et al. @virusesimmunity team shows that RIG-I agonist stem loop RNA (SLR) triggers potent antiviral defense against #SARSCoV2 to prevent primary infection and clear chronic infection. bit.ly/3wwnlhP #COVID19 #InfectiousDisease #HostDefense

Wordle 200 3/6 🟩🟨🟨🟩⬛ 🟩🟩🟨🟩⬛ 🟩🟩🟩🟩🟩

Wordle 201 2/6 🟨⬛🟨🟨⬛ 🟩🟩🟩🟩🟩

@@ / M@me@@

AATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAGAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAAAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTGA

Wordle 297 2/6 🟨⬛⬛⬛🟨 🟩🟩🟩🟩🟩