
Bioplatforms Australia
@bioplatformsaus
Bioplatforms Australia provides services and scientific infrastructure in the fields of genomics, proteomics, metabolomics and bioinformatics #NCRISimpact
ID: 586321264
http://www.bioplatforms.com 21-05-2012 06:57:58
2,2K Tweet
2,2K Followers
1,1K Following

Jimmy Breen
@wessidepraxis
President of @ABACBS 丨 Chief Data Scientist, Indigenous Genomics @ Telethon Kids Institute丨jimmymbreen ⟦at⟧ gmail
Prof Emma L Johnston AO FAA FTSE
@dremmaljohnston
Prof of Marine Ecology & Ecotoxicology. Director on the board of CSIRO and IPF.
wei dong
@weijiahao075

Nick Wong AU/MEL
@methylnick
Molecular Cowboy. Computers are toys and tools. Tweets are my own. Buy Me a Coffee ko-fi.com/methylnick
Torsten Seemann
@torstenseemann
Microbial genomics, bioinformatics software, training. A/Prof ORCID: 0000-0001-6046-610X Retro 8-bit computers; VIC=20, C=64, C=128.
Agustín
@agus3260
Biólogo computacional. Docente universitario.Educación pública, gratuita y de calidad. #Pop🎶 🏳️🌈🇦🇷
Maria Ermakova
@mary_in_vivo
Plant 🌱 Energy ☀️ Biotechnology 🧬 Group leader @MonashBiol
Ibukun Adesoji Adejumobi
@laceonline02
Cancer Biologist. My tweets are my op
Anthony Beckhouse
@antobeck
PhD qualified scientist working in genomics marketing for @illumina. All views posted are mine. Dad, husband, nerd, MAMIL 🚴
Science & Technology Australia
@scienceau
Science & Technology Australia gives voice to 235,000+ scientists & technologists. We run #ScienceMeetsParliament #SuperstarsOfSTEM & #STEMambassadors programs
Australian Research Data Commons (ARDC)
@ardc_au
Australia's leading research data infrastructure facility. We are no longer posting to X. We're on LinkedIn + subscribe to our newsletter ardc.edu.au/subscribe/
Kara Dicks
@kara_dicks
Wildlife & conservation genetics/omics, evolutionary ecology. Conservation geneticist @nanopore, but views are my own.
Kathy Belov
@kathybelov
Professor of Comparative Genomics studying Australian animals, inc Tasmanian devil & koala. Currently PVC Global & Research Engagement @sydney_uni.
Laurence Luu
@laurenceluu
Scientia lecturer @UNSWBABS | Microbiologist | NHMRC EL1 Investigator Fellow | Fascinated by all the smaller things in life 🤧🤧
A/Prof Amy Cain
@flamycain
ARC Future Fellow @MQnatSci 🇦🇺 she/her | @jamsorgau @aussocmic| Functional 🧬,💊discovery, Synbio, 🐛, ♻️| Ex-@sangerinstitute @VertexPharma @Mlw_Programme
Alicia Oshlack
@aliciaoshlack
Bioinformatics, computational biology, genomics, Women in Science
Jason "boundless delight " Williams
@jasonwilliamsny
Asst. Dir. @DNALC @CSHL/ @CyVerseOrg /@thecarpentries/#AreciboC3/ #Foodie #ClassicalMusic #StarTrek /lifescitrainers.org —my own opinions.
COMBINE
@combine_au
Supporting students in Bioinformatics & CompBio. Subcommittee of @ABACBS & Australian @iscbsc Regional Student Group. Join us on slack 👉bit.ly/COMBINESLACK
Prof Carolyn Hogg
@hoggcarolyn
Population Biologist at the University of Sydney specialising in threatened species. Views are my own. @Sydney_Uni @Sydney_Science
Victor Olet
@victorolet
#ChemEng #Chemistry #CompChem PhD Candidate @CurtinUni | Generating green liquid #biofuels | Gold Microsoft Student Ambassador | 2023 @windowsinsider MVP
Matt Ritchie
@mritchieau
Everything is R-some #rstats #bioconductor #genomics #singlecell #bioinformatics mritchieau.bsky.social
revolio
@revolios
Contrarian. Governed by self- words. (selfish is not a self- word btw) Traveller. Flaneur. Altruist. Supporter of Decentralise Australia movement.
Arullthevan Rajendram
@arullthevan
Doctoral Student. Plant Immunity Lab, NAIST. In the path to be an aspiring plant molecular biologist. Also, Arsenal FC fan 😇
Chetan Sharma, PhD
@chetan_cdri
#postdoc #Metabolomics #MassSpectrometry #GC-MS #LC-MS/MS #Chemicalecology #phytochemistry #biosynthesis [email protected]
Neil Gemmell
@profgemmell
Geneticist @Otago. Pure + applied science. Gaffs/typos due to lack of coffee, time, and maybe mind-altering parasites. Rebel just for kicks.
Dr. Suresh Kumar Mendem
@sureshmendem
AMR,Genomics, Epidemiology, Microbiology, Bioinformatics, Molecular biology, Host-pathogen interactions
ARC Centre of Excellence in Synthetic Biology
@arc_coesb
The ARC Centre of Excellence in Synthetic Biology (CoESB) is developing a vibrant bioeconomy based on Australia's strengths. Also on arccoesb.bsky.social
International Congress of Genetics 2023
@genetics2023
In July 2023 Melbourne, Australia hosted a huge Genetics Congress. Info at icg2023.com.au. Cape Town 2028 is the next Congress.
@Mercerlab
@mercerlab1
All things genomics.
Dr. Kate Quigley
@la__cientifica
Molecular Ecologist Principal Research @minderoo ARC DECRA Fellow @jcu @uwaoceans @natgeo Explorer A.Ed. @MethodsEcolEvol @Peacecorps @TEDx
TIA
@tia_aust
Lead agent for NCRIS "Therapeutic Innovation Australia" project supporting access to a network of Australian translational research infrastructure
Efraín MP 🇲🇽🧬
@mp_efrain
Just a guy studying a genomics undergrad @lcgejunam
Shiva DEVKOTA
@fungashiva
Mycologist from Nepal, Interest on 🍄, Lichens, Mycotourism Member @IUCNfungi Explorer @spununderground Fellow @IPBES PhD @WSL_research #NepalFunga
Mr. Unknown
@mrunknown157
Dreamer
DIKSHA BISHT
@dikshabishtt
Ph.D. Scholar| PlantMolecularBiology| University of Delhi| Research and Mountains|
TrendRiderPro🇺🇸
@qarhirb420
15-30% Monthly | 2 High-Conviction Stocks.Short-Term Gains: 15-20% in Days/Weeks.DM "JOIN" for WhatsApp Alerts. Live Trade Signals • Market Analysis
Dio Brandon
@diobrandon61606

Jon
@jonzs_0

un
@mahmu92823

kruthi rao
@_kruthirao_
Bioinformatics , Equestrian
[email protected]
@robertzeibich

Jerzy H. Czembor 2022
@czemborh
#genebank #plantpathology #biodiversity #plantbreeding #agriculture #foodsecurity #greendeal #climatechange #barley #powderymildew #IHAR #food #agrobank
Ibnyusuf
@ibnyusuf577
Future Bioinformatician | Public Health & Data Science Explorer
Serhan Turunç
@serhan_turunc

Minghui (Elena) Zhu
@elenazhu17
PhD student at Unimelb
Billy Trim
@blytrm
UniAdl: BSc (ADV) (Hons) (Genetics) CATCTGATCATCGACAGCTAGCACCTGACA
Thares
@tharesz41s

Baz
@madoggbodactous

APBC2025
@apbc2025
The 17th Australasian Plant Breeding Conference (APBC) will be held at the Esplanade Hotel Freemantle, WA on 4-6 June 2025🌱
Dr. Gurdarshan Singh Rangra
@gurdarshanrangr
(PhD Botany) Working on cyanobacteria and water quality of wetlands......
munir heart keeper
@munirheart

DANAMMA KALAVIKATTE
@dkalavikatte
Bioinformatician | Liver Cancer | DNA methylation l Organoids l Machine Learning
M M
@minnajaipaul

Adelaide Bioinformatics
@doppeldata
We provide support to researchers, students & professionals in bioinformatics, genomics & computational biology through tailored tools, workshops & resources.
Yongle Leo Li
@leoyongle

MadelineNora
@wnex8jl720rija8

DonnaEdith
@za3q6f24gmjj66

Donovin Coles, PhD
@colesdonovin
Plant Pathology postdoctoral fellow developing novel disease management strategies for broccolini | @ProfIanAnderson group | @westsyduhie |🇿🇦🇦🇺⛰️🌊
Simon Lobos
@selobos_
PhD Candidate | Centre for Integrative Ecology |School of Life and Environmental Sciences | Deakin University 🌱🧬
Takashi Nishina
@nishina_takashi
Researcher #Tumor, #Immunology, #Fibroblasts, #Intestine, #Inflammation, #CAFs Toho University, Views are my own. In bluesky, @takashi-nishina.bsky.social
Global Microbiome Congress 2025
@microbiome2025
Sciinov Group welcomes you to the “ Global Microbiome Congress (GMC 2025)” HYBRID EVENT during May 12-13, 2025 in Paris, France
Sadaf Khan
@i_amsadaf
Biotechnologist
Farahnaz Golestan Hashemi
@farahnazgol

EcoGenomics ANU
@ebl_anu
Niccy Aitken tweeting for EcoGenomics and BioInformatics Facility at Australian National University. Providing resources for @scienceANU and @CSIROnews.
PRASHANTH GOUDA
@policegoudru
Prash gouda
Evadne
@minatog82836258

DIVA's
@divakars_
(°_°) In the quest of unknown-unknown! | A doctoral researcher exploiting and engineering the plant dynamics Science & Art Illustrator/communicator @thelazydna
Chloe Nguyen
@chloenguye96486

fadi gaied
@fadi_gaied
Sousse