Beer DeCoded (@beerdecoded) 's Twitter Profile
Beer DeCoded

@beerdecoded

Send your beer ▸▸ we analyze them ▸▸ we draw a molecular map ▸▸ we give you the map back ▸▸ you discover new beers.

ID: 3295237359

linkhttp://genome.beer calendar_today23-05-2015 14:19:48

617 Tweet

474 Followers

551 Following

Beer DeCoded (@beerdecoded) 's Twitter Profile Photo
Beer DeCoded
@beerdecoded

7 years ago

👊🔍💣 x.com/hackuarium/sta…

Naiane (@naiane_rios) 's Twitter Profile Photo
Naiane
@naiane_rios

7 years ago

If you're in Lausanne Area join us at the Hackuarium TONIGHT 7 PM to talk about GMOs and to test the GMO Detective kit. Bring your food to test and register here 👉 tinyurl.com/y9tmjfen #openscience #biohack

If you're in Lausanne Area join us at the <a href="/hackuarium/">Hackuarium</a> TONIGHT 7 PM to talk about GMOs and to test the GMO Detective kit. Bring your food to test and register here 👉 tinyurl.com/y9tmjfen #openscience #biohack
F1000 (@f1000) 's Twitter Profile Photo
F1000
@f1000

7 years ago

Hoppy Friday! For #NationalBeerDay why not explore the beer metagenome with Beer DeCoded and their scientific quest to understand beer at a molecular level. #CitizenScience #DNAsequencing #DIYBio Hackuarium blog.f1000.com/2017/11/03/bee…

Hoppy Friday! For #NationalBeerDay why not explore the beer metagenome with <a href="/beerdecoded/">Beer DeCoded</a> and their scientific quest to understand beer at a molecular level. #CitizenScience #DNAsequencing #DIYBio <a href="/hackuarium/">Hackuarium</a> blog.f1000.com/2017/11/03/bee…
Milad Miladi (@miladmiladi_) 's Twitter Profile Photo
Milad Miladi
@miladmiladi_

7 years ago

.Oxford Nanopore + Beer: Today we pour Beer into the MinION's pores! Sequencing yeast extracted from Beer with Nanopore. Together with wonderful Blackforest-Backstreet citizen-science team: @NothSteph Björn Grüning Bérénice Batut Teresa Müller @Spike_Black_Sun Melanie C. Föll أبو صامل

.<a href="/nanopore/">Oxford Nanopore</a> + Beer: Today we pour Beer into the MinION's pores! Sequencing yeast extracted from Beer with Nanopore. Together with wonderful Blackforest-Backstreet citizen-science team: @NothSteph <a href="/bjoerngruening/">Björn Grüning</a> <a href="/bebatut/">Bérénice Batut</a> <a href="/tesamueller/">Teresa Müller</a> @Spike_Black_Sun <a href="/MCFoell/">Melanie C. Föll</a> <a href="/couac/">أبو صامل</a>
Beer DeCoded (@beerdecoded) 's Twitter Profile Photo
Beer DeCoded
@beerdecoded

7 years ago

This!

The Open Food Repo (@foodrepo_org) 's Twitter Profile Photo
The Open Food Repo
@foodrepo_org

6 years ago

Our 1st food DNA workshop was a success! Featured now on EPFL homepage - read all about it👇and see some pics. Many thanks to the participants, who made it such a fun and productive day Hackuarium bit.ly/2Vq0FAv #CitizenScience #FoodTransparency Opinion from FRC

Our 1st food DNA workshop was a success! Featured now on <a href="/EPFL/">EPFL</a> homepage - read all about it👇and see some pics. Many thanks to the participants, who made it such a fun and productive day <a href="/hackuarium/">Hackuarium</a> bit.ly/2Vq0FAv #CitizenScience #FoodTransparency Opinion from <a href="/frc_CH/">FRC</a>
The Open Food Repo (@foodrepo_org) 's Twitter Profile Photo
The Open Food Repo
@foodrepo_org

6 years ago

Found in fish fingers. Can you ID?🤓 🧬🐟CGACTGTTTTACCAAAAACATCACCTCTTGCTCAAATATAAGAATTTGCCTGCCCTGTGACTATAAGTTTAACGGCCGCGGTATTTTAACCGTGCGAAGGTAGCGTAATCACTTTGATAAATGAAGACCTGTATGAATGGCATCACGAGGGCTTAGCTGTCTCCCATCTCCAGTCAATGAGGTGACACTCCCGTCTGAGGCAGGGGATAATTACATAAGACAGAGAGAAGACCCTGTGG

Beer DeCoded (@beerdecoded) 's Twitter Profile Photo
Beer DeCoded
@beerdecoded

6 years ago

Add some beers and kombucha please 😛

Jonathan Sobel (@jonathansobel1) 's Twitter Profile Photo
Jonathan Sobel
@jonathansobel1

5 years ago

A new very nice study entitled "Characteristics of bacterial and yeast #microbiomes in spontaneous and and mixed-fermentation #beer and #cider" sciencedirect.com/science/articl… it's great to see our #beerdecoded data-set compared and reanalysed.

Martin Smith (@martinalexsmith) 's Twitter Profile Photo
Martin Smith
@martinalexsmith

5 years ago

Beer can only taste better with this #RNA structure tap handle I designed #3Dprinting

Beer DeCoded (@beerdecoded) 's Twitter Profile Photo
Beer DeCoded
@beerdecoded

8 years ago

#BlackFridayDeals x.com/jonathansobel1…

Product Hunt Switzerland (@producthunt_ch) 's Twitter Profile Photo
Product Hunt Switzerland
@producthunt_ch

8 years ago

4th speaker : Jonathan Sobel (Jonathan Sobel) from Beer DeCoded Presenting genome.beer understanding science through beer. #opendata November 28 7pm @ ImpactHub Lausanne facebook.com/events/1911166…

4th speaker : <a href="/JonathanSobel1/">Jonathan Sobel</a> (Jonathan Sobel) from <a href="/beerdecoded/">Beer DeCoded</a> Presenting genome.beer understanding science through beer. #opendata November 28 7pm @ ImpactHub Lausanne facebook.com/events/1911166…
Beer DeCoded (@beerdecoded) 's Twitter Profile Photo
Beer DeCoded
@beerdecoded

8 years ago

See you tonight at Impact Hub Network x.com/producthuntsr/…

Product Hunt Switzerland (@producthunt_ch) 's Twitter Profile Photo
Product Hunt Switzerland
@producthunt_ch

8 years ago

600 micro brasseries en suisse! Beer DeCoded pour @ProductHuntSR Le génome de la biere mappé!

600 micro brasseries en suisse! <a href="/beerdecoded/">Beer DeCoded</a> pour @ProductHuntSR Le génome de la biere mappé!
Beer DeCoded (@beerdecoded) 's Twitter Profile Photo
Beer DeCoded
@beerdecoded

8 years ago

Hoppy #Xmastree 🌲 x.com/f1000research/…

Beer DeCoded (@beerdecoded) 's Twitter Profile Photo
Beer DeCoded
@beerdecoded

8 years ago

fb.me/LaPAVKLE

Beer DeCoded (@beerdecoded) 's Twitter Profile Photo
Beer DeCoded
@beerdecoded

8 years ago

Something’s Brewing in the Lab: Beer Without Hops - The New York Times nytimes.com/2018/03/20/sci…