spectra..............................

IT'S MIDNIGHT WHERE I LIVE SO IT'S FINALLY APRIL 12
2 years ago I saw Super Animal Royale Tonight for the first time and since then it's the only thing that controls my mind
Many thanks to Pixile Studios for existing this series changed my life thank you thANKS,,

I did what I could BLEKEBEKSWJE
#scottpilgrim #scottpilgrim takesoff #kniveschau #stephenstills

Mis next Mane six edit base pero a mi estilo

uuagagauauugagauauuaagauaugaagagag #bnha

I’m swear these two are my favorite oc x canon ship ever and THEYRE MY SHIP TOO!! Ough I need to learn poses better so I can draw them being IN LOOOVE

Hola *Le tira sona de avatar*

Les presento a Mailing, una maestra fuego de la nación del fuego, fue a la academia real del fuego para chicas donde ahí se hizo amiga de Mai, Ty Lee y a su futura novia Azula

En ese grupo, solo Azula y ella tienen el poder de manipular el fuego

kamisero yyeeyyy....

Nostalogic Pero esta vez Es Demoman ♡

Jsjsj WIP 2

Mister lazos why the fuck are you a magical girl?? Miss Pauling literally needs you??

#ocart #tf2oc

BESTIE HABLÓ
YO OBEDEZCO

Aqua dijo que Carl era Sans y eso derivó en que creara un SARtale

I love Haley and she loves me 💛

Más que ss, es canónico pues estamos casadas en el juego, fue mi primer interés romántico desde el momento que empecé a jugar 💛

Se llaman Fashion Farm

#StardewValley #StardewValley fanart #sstwt #haley

good morning

Este probablemente sigue siendo mi mejor dibujo de ellos dos

I don’t draw this guy often I think maybe I should
*doesn’t draw him*
*doesn’t draw him*
*doesn’t draw him*

#ocart

Debo hacer otro dibujo Jaxminn pq este lo ando quemando AJSHKAJS

Holi, aquí mi ss poli amoroso con Starlight Glimmer y Rarity, mi sona se llama Sunflower Blossom

Mi ss se llama Magical flowers fashion o Rarilight Blossom

#sstwt #mlp #Magicalflowersfashion

El papercraft de Pav m lo regalo una amiga, los demás papercrafts los arme yo sjdjsjsj
Le puse un ganchito al Alastor peluche :3
Sero peluche ayudenlo ya lleva casi 3 años conmigo AKSHAJSJ

more of these guys