Putting bitcoin in your retirement account is one of the best ways to ensure long-term thinking, while significantly reducing your tax bill. Chris Kline (Chris Kline) runs a company that is empowering people to do exactly this, so we sat down to discuss how it works, what

Just now: Arc Institute and NVIDIA release Evo 2, the largest AI model for biology. It is fully open-source. Evo 2 can predict which mutations in a gene are likely to be pathogenic, or even design entire eukaryotic genomes. We covered it in Asimov Press! Check it out 🔻

Issue 6 of Asimov Press incoming! It is a whopper of an issue with beautiful illustrations and incredible pieces — a powerful memoir, sci-fi, a killer book review, and more great biotech. You can get a preview here and read about some exciting updates!

We are profoundly grateful to Jennifer for sharing her story with us. I first met with her in Cambridge, many months ago. Writing this story was a deep (and painful) labor of love. Hopefully this story will be helpful to other women navigating IVF and embryo screening.

Some final photos of the new Asimov Press book for today... The book has lots of nice images & the stickers turned out great. Also, none of this would have been possible without financial support from Asimov, Astera Institute, and Stripe. Thank you!

Asimov Press. Book Unboxing. Encoded in English and DNA. Designed by Everything Studio | Brooklyn, NY Printed by Shapco | Minneapolis, MN Published by Asimov Press | San Francisco, CA CATGATGACAGCTAGCGTCTAAGCCATTGTTGTTCGACG

The world’s first commercially-available book written in DNA. ⁦Asimov Press⁩

Even having prepared myself for how cool the Asimov Press DNA + book pair would be, it exceeded my expectations. Thank you! (Obviously to continue raising the bar, the next book will have to come with a synthetic organism.)

One of the coolest things I own. Thank you, Asimov Press!!!

A single E. coli is 70 percent water. The other 30 percent is mostly proteins. A single type, called Lpp, accounts for ~1/3 of all proteins in a cell. It takes less energy to build a cell than it takes to lift an apple from the ground to a height of one meter. New post by me🔻

My first DNA-encoded book. Just landed in a London. Love it! Tempted to smash it open and shotgun clone it into yeast cells to see which parts of the book help yeast grow quicker. Thanks Niko McCarty. and everyone at Asimov Press Alec Nielsen

Can’t wait to read this over the Easter break! Brilliant work Niko McCarty 🧫 Asimov Press , the sheer quality of the book and its presentation is top notch, you’ve pulled out all the stops! Is it strange that the minute we get our hands on some DNA we want to send it fr sequencing?

A book... written on DNA?! One of the most fascinating things in my collection. An anthology of essays on DNA and bio-tech, synthesized into thousands of strands of DNA and encapsulated. Well done @asimovpress @catalogtechnic @nikomccarty My next quest: understanding the the

I'll be living near Stanford this summer, from ~June 10 to August 10. I'm hoping to meet lots of people and learn a lot more about AI+Bio efforts. Let's hang out!

Rostra is an AI-powered tool that reduces hallucinations, bias, and policy breaches before they reach users. We connect with 24 top-performing AI models to spot errors in real-time, and our tools work with your company's workflow. Get in touch: rostra.ai

We benchmarked the factual accuracy of Rostra against leading AI models, including GPT-4.1 and Claude 3.5, on 250 random Jeopardy! questions. Rostra outperformed all other models, with an error rate of 4.2 percent. GPT-4.1 error rate of 6.7%; Claude 3.5 Haiku error rate > 16%.

Every AI model makes mistakes. But rather than trusting answers from a single AI model, our Best Answers tool collects opinions from a quorum of models and then returns only what multiple engines—and internal or external evidence—confirm to be true. NEW BLOG POST 🔻

We’re building a no-code “clearinghouse” for AI models. You can run a prompt across multiple models at once and then compare their outputs side-by-side, or send prompts to individual models. We currently integrate with 25 leading AI models, so you only need one subscription.