Teams composed of just a few people are more likely to produce highly novel (disruptive) work, while larger teams may be best for going big and developing an idea. This notion is supported by classic work by Lingfei Wu, Dashun Wang, and James Evans. nature.com/articles/s4158…

▶️Listen to the article "Liquid biopsies for residual disease and recurrence" by J. Chee Ming Wan, N. Rosenfeld et al. rss.com/podcasts/pub-r… 🔊 Scott Kopetz Jonathan C M Wan #Cancer #Biopsies #PubReading #Podcast 🎙️

How the time of day may affect cancer treatment nature.com/articles/d4158… nature Nature News & Views

A #machinelearning model that utilizes longitudinal #ctDNA metrics robustly predicts survival in two phase 3 trials of patients with metastatic #NSCLC, which may improve therapy selection and risk stratification. Genentech nature.com/articles/s4159…

So excited to see this out after 2.5 years of work, learning and more than a few frustrations... Congrats to the rest of the team MedEd Collaborative tandfonline.com/doi/full/10.10…

I am very pleased to be listed by the MIT Technology Review as an Innovator Under 35! Thanks to my clinical and academic mentors at UCLH Memorial Sloan Kettering Cancer Center CRUK Cambridge Institute Guy's Cancer Charity for supporting me toward my goal of earlier cancer detection using #liquidbiopsy. EmTech Europe

📢Innovator announcement Jonathan C M Wan is a physician-scientist & focuses on developing new, more sensitive methods for detecting cancer in blood using circulating tumour DNA (ctDNA) & will be honoured at this years #MITIU35Europe Festival More details👉bit.ly/3nExsRa

A brief reflection on the exceptional fertility of graveyards...(!) Thanks to Nature Cancer and editor @LisaHass0107 for the invitation, and to Memorial Sloan Kettering Cancer Center and Johns Hopkins Medicine for supporting the freedom to explore. rdcu.be/dcZQv

Consultants in England have voted a resounding YES to taking industrial action this July. ✅Turnout: 71.08% ✅Yes votes: 20,741 – 86.08% Together we can #FixConsultantPay now and for the future. Read more: bma.org.uk/consultantspay

Have a look at our Forum article on 'Leveraging circulating microbial DNA for early cancer detection' in Trends in Cancer! authors.elsevier.com/sd/article/S24… #Cancer #cfDNA #microbiome

Cancer Research UK to fund new Charlie Massie Doctoral Research Fellowship in memory of our fantastic colleague. The first recipient will start in Harveer Dev lab in autumn.

🏥 Announcing new study #MEDNURSE 👩‍⚕️Are you a final year medical or nursing student or a recent clinical educator? ✨ Share your experiences of service and learning in our online interviews ✨ Help shape the future of clinical education! Interested? newcastle.onlinesurveys.ac.uk/mednurse-expre…

📢 PhD opportunity in my lab Early Cancer Institute, University of Cambridge CRUK Cambridge Centre to unravel the story of how somatic evolution drives cancer working with great collaborators at UCL & The Crick. Drive, curiosity and kind-heartedness are essential. We teach the rest tinyurl.com/5n7rb5rr

Our view of the #Volcano from #Reykjavík, plus one we took just hours earlier #Iceland by ~ Becca ~

ATGGAGAGGAGGTACTGCCACAGGATCAGCACCATGGCCAGCGCCAACGACGCCCACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG from everyone at Ensembl

Natera Wins Preliminary Injunction Against NeoGenomics Labs, Preventing Sale of MRD Assay in US. NeoGenomics may continue to offer the assay for existing patients and for clinical trials, research studies, and projects already in process. ow.ly/TVSp10577ZP

📣ARE YOU A MEDICAL STUDENT IN THE UK?📣 🩺We are studying UK foundation programme selection criteria, trying to find if there is a more fair and equitable way forwards Want to help us? Fill out our survey now: tiny.cc/SELECT

Delighted to share a link to my paper on "Promises and pitfalls of multi-cancer early detection using liquid biopsy tests" published in Nature Reviews Clinical Oncology NatureRevClinOncol with Jonathan C M Wan and Nitzan Rosenfeld #MCED Wolfson Institute of Population Health Barts Cancer Institute (Queen Mary) rdcu.be/eqRQo

Hi all, we have funding for two resident doctors- post fy2-st6 to a Hpb medical oncology clinical research fellowship in Birmingham. They would do our clinical trials clinic, a standard of care clinic and have two research days a week. Please let any suitable trainees know.

Very proud of the team for pushing Pleiades over the finish line 💖🦈 Excited for all that's ahead Ravi Solanki, Hannah Madan, Pouya Yanki, Christoforos, Jay Ganbat, Donal Byrne, Tim Liu, Jonathan C M Wan, Ivan Koychev, Husam Babikir, Devin Gilliam, Hayley Holt, Anjeet Jhutty.