I´m thrilled to see our #LRGASP paper published in Nature Methods today. This is the work of many to benchmark long-read methods for transcriptomics, and a must-read paper for those using lrRNA-seq. Special thnks to Francisco Pardo-Palacios and Brooks Lab (1/6) rdcu.be/dJ9ev

Sorry it’s taken so long to make it happen, but we’re super close now

In the pantheon of liquid rocket engines, full flow unquestionably sits alone at the top. Hard? Yes. But needed for full reuse and long life. Unbelievably proud of our little team for pulling this off! #ffsc #fullflow

Analysis of 170 PacBio HiFi genomes identified 7000+ segmentation duplications (SD) that comprise 6.1% of the (T2T CHM13) genome. African genomes show higher copy number of multi-copy SDs. Comparing to Iso-Seq data finds 201 novel protein-coding gene in multicopy SDs.

Jake Sullivan's unimpeded obstruction in Ukraine makes a lot more sense after tonight....

Great news for global genomics research! inqaba biotec and Unisa have acquired Africa's first #Revio system. With Onso already on board, this marks a major advancement for the Africa BioGenome Project in sequencing African genomes locally. Congrats to all involved!

Sometimes innovation in biotech is creating the newest and most advanced genetic synbio toolset Sometimes it's realising that you can use a caulking gun to more reliably and safely load the Akta superloop without cramping your hands or potentially breaking off the luer lock port

Navigating the world of long-read #sequencing can be complex, so we're here to help! Our latest blog breaks down key factors like accuracy, cost, and application fit. Make informed decisions to elevate your #genomics research! 🧬 #PacBio bit.ly/46cQMqR

📢 New #HiFi yield record at Edinburgh Genomics! Our #Revio just smashed it with 510Gb of #HiFi reads across 4 SMRT cells, and a jaw-dropping yield of 137.8 Gb on one cell! 🙌 Huge shoutout to Caitlin for this Olympic-level performance! 🥇👏 PacBio #IsoSeq #Kinnex #RNA 🧬🐑🐕

Have you registered yet for this year's ASHG #ASHG2024?! Don't miss the date to register early! I just did and I'm excited to be moderating an interesting session on Mosaicism, this year's scientific program & catching up with everyone! See you all in Denver! #ASHG24

It's official, PacBio has launched a new benchtop sequencer! Quick summary of the new Vega system: - instrument = $169k - consumables = $1100 per run - output = 60 Gbp, 24 hr run time This is the #HiFi sequencer #microbiology labs have been asking for. pacb.com/press_releases…

Christian Henry, President & CEO of PacBio, on Azenta becoming the first commercial provider of #Clinical long-read WGS in the U.S. Discover how this will enable breakthroughs in #PatientCare & #PrecisionMedicine: hubs.ly/Q02WqQmP0 #ClinicalTrials #PacBio #HiFiSequencing

Got to see the amazing new PacBio desktop long-read system. The price is nice and surprisingly the reagent price is close to its bigger sibling. #PAG32

So excited to see who this soapieboi is!!!

RESULTS!!! Okay so got 12k reads (bug seems very hard to crack) but the kind folks at plasmidsaurus.bsky.social offered to rerun. In the meantime, I'm getting some very strong blast hits for a recently discovered species, Edaphobacter flagellatus. FASTQ: drive.google.com/drive/folders/…

Okay time to dig in my freezer and find my 16s primers. Gonna send amplicons out to plasmidsaurus to see if the colonies that grew on LB are our E. flagellatus tritonivores or some other critter. Grew nicely overnight in LB broth (miller mod).

No luck finding them so gonna order a fresh set. Here are the primers I use, 5'->3': 16s-27F AGAGTTTGATCCTGGCTCAG 16s-338R TGCTGCCTCCCGTAGGAGT 16s-1392R GGTTACCTTGTTACGACTT 16s-longRG-FCCGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG 16s-longRG-R CCCGGGATCCAAGCTTACGGCTACCTTGTTACGACTT

Ladies if you go to his apartment and his fridge is full of sequencing primers for his plasmid collection you DO NOT date him you deserve a man who does whole plasmid sequencing