🔥The 9th Round of Easy Loan, Earn $40 Reward is in progress❗️ ⏰ Promotion Period: January 15th - Feburary 15th, 2025 👉 Register now and check more details at gate.io/campaigns/358

Our colleagues will be there - join to learn and meet&greet! West German Genome Center CCGA Kiel NCCT DRESDEN-concept Genome Center

6 years, a dream team of collabs and a pinch of patience: our work on the role of senescent cells in regeneration it is out Developmental Cell : cell.com/developmental-…. Tx Andy Yu, Hannah Walters Sumeet Pal Singh DRESDEN-concept Genome Center Andrea Bernardos Bau Giovanni Pasquini Daniel León-Periñán CRTD MPI-CBG Dresden

Our very first 10x Genomics #Xenium experiment being presented at the AGD Meeting! Exciting results are building up!!

If you are interested in #biodiversity and #genomics, one or the other, or even wondering how they come together... make sure to watch this seminar: *proudly sponsored by the @NGSCN1 😉

Join us for the upcoming MPI-CBG Dresden & Physics of Life Dresden symposium on Machine Learning in Biology, November 29th, taking place MPI-CBG Dresden. Everybody is welcome!

Become part of the #GHGAsquad at Universität Tübingen! We are looking for a scientific project manager at our data hub in Tübingen, supporting our central project management team and training efforts! More at ghga.de/about-us/jobs

Our #LIMS system got a major backend improvement, thanks to the magic brains & hands of our IT experts! At the frontend, the main diff. to users is the new name, Rosalind, our team's tribute to #RosalindFranklin, one of the greatest #womeninscience and role model to many us.

It was our pleasure to host such a fantastic line up of speakers!

🎧 All sketches for the released Explain Podcast episodes can be found on our Insta Dictionary.pod You're welcome! instagram.com/explain.pod Choose the platform to listen to a podcast - Spotify supports chapters! ngs-kn.de/explain-podcas…

CACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG! Our team wishes you a wonderful and successful 2024! We are looking forward to many exciting new projects and collaborations :))) #frohesneues

Great news! DFG public | @[email protected] offers opportunities to apply for funding high sequencing costs projects together with academic sequencing institutions e.g. DRESDEN-concept Genome Center | West German Genome Center | NCCT | CCGA Kiel Excited? Check here dfg.de/de/aktuelles/n…

Publication in nature with the participation of MPI-CBG Dresden. The genome of the lungfish was sequenced and assembled by Gene Myers Eugene W Myers Jr, Director Emeritus MPI-CBG Dresden, and the team of the DRESDEN-concept Genome Center.

DcGC will no longer be posting on this platform. Account remains as an archive. We'll be further communicating our news on: - Website genomecenter.tu-dresden.de - LinkedIn linkedin.com/company/dresde…