Arun (@arun26feb) 's Twitter Profile
Arun

@arun26feb

ID: 907516494690476033

calendar_today12-09-2017 08:09:27

61 Tweet

17 Followers

99 Following

Kenneth W Witwer (he/him) (@kennethwwitwer) 's Twitter Profile Photo

Summary by @bonita_powell of “Pairing to the #miRNA 3′ region occurs through two alternative binding modes w/affinity shaped by nucleotide identity & pairing position” from the Bartel lab biorxiv.org/content/10.110… Marc Halushka MD PhD LabWitwer #MeffertLab BCMB Graduate Program at JHMI #miRNAJournalClub

Summary by @bonita_powell of “Pairing to the #miRNA 3′ region occurs through two alternative binding modes w/affinity shaped by nucleotide identity &amp; pairing position” from the Bartel lab biorxiv.org/content/10.110… <a href="/Marc_Halushka/">Marc Halushka MD PhD</a> <a href="/LabWitwer/">LabWitwer</a> #MeffertLab <a href="/BCMB_JHMI/">BCMB Graduate Program at JHMI</a> #miRNAJournalClub
Marc Halushka MD PhD (@marc_halushka) 's Twitter Profile Photo

Want to know if your favorite microRNA is expressed in the cells you investigate? We've got 196 answers for you! "A curated human cellular microRNAome based on 196 primary cell types" biorxiv.org/content/10.110… Congrats to Arun, Matthew N. McCall, Zach Brehm and Andrea Baran.

Marc Halushka MD PhD (@marc_halushka) 's Twitter Profile Photo

Best biological reagent ever obtained in the Halushka laboratory. USBiological salsa. I kid you not. Enjoyed it at our lab meeting yesterday and it was DELICIOUS!

Best biological reagent ever obtained in the Halushka laboratory.  <a href="/USBiological/">USBiological</a> salsa. I kid you not. Enjoyed it at our lab meeting yesterday and it was DELICIOUS!
Elisabeth Bik (@microbiomdigest) 's Twitter Profile Photo

Science leaders demand crackdown on medical research fraudsters after allegations that pivotal Alzheimer's study contained manipulated data - giving false hope to families and slowing the development of effective treatments Barney Calman @ Mail on Sunday dailymail.co.uk/health/article…

Marc Halushka MD PhD (@marc_halushka) 's Twitter Profile Photo

Anyone in the #tunicate, #ciona, tunicate, sea squirt community know what this dense matrix material is in the wall of a Ciona Robusta? Muscle cells at bottom in H&E for size reference.

Anyone in the  #tunicate, #ciona, tunicate, sea squirt community know what this dense matrix material is in the wall of a Ciona Robusta? Muscle cells at bottom in H&amp;E for size reference.
Arun (@arun26feb) 's Twitter Profile Photo

Beware of fare hard drives (HDD/SSD) on #AmazonPrimeDay #amazon and similar providers. Especially new brands and “made in China”.

Arun (@arun26feb) 's Twitter Profile Photo

High impact journals doesn’t always mean quality research. Our journey/experience of such concerns is shared. ⁦Retraction Watch⁩ retractionwatch.com/2022/10/22/wee…

Marc Halushka MD PhD (@marc_halushka) 's Twitter Profile Photo

~~ANNOUNCING the HALUSHKA-X PRIZE~~ $100 Amazon Gift Card to the first person to identify the sequence "TCTTGCAATTAAAAGGGGGAA" in human RNA-seq data. Details of the competition here: tinyurl.com/5n6z5wsx.

Tivadar Danka (@tivadardanka) 's Twitter Profile Photo

Behold one of the mightiest tools in mathematics: the camel principle. I am dead serious. Deep down, this tiny rule is the cog in many methods. Ones that you use every day. Here is what it is, how it works, and why it is essential.

Behold one of the mightiest tools in mathematics: the camel principle.

I am dead serious. Deep down, this tiny rule is the cog in many methods. Ones that you use every day.

Here is what it is, how it works, and why it is essential.
Chris Toseland (@christoseland) 's Twitter Profile Photo

I don’t usually post personal news but Clinicians have told us to pull every lever. Our daughter has with #dipg Brain cancer. There is no cure and typically 9m life expectancy. If anyone knows of trials then please get in contact! #braincancer #childrenscancer Cancer Research UK

I don’t usually post personal news but Clinicians have told us to pull every lever.

Our daughter has with #dipg Brain cancer. There is no cure and typically 9m life expectancy.

If anyone knows of trials then please get in contact! #braincancer #childrenscancer <a href="/CR_UK/">Cancer Research UK</a>
Anshul Saxena (@askanshul) 's Twitter Profile Photo

An Indian student Jaahnavi Kandula from Andhra Pradesh was studying in USA. She was killed in a road accident by a Police car in January 2023. Now, 8 months after accident, a bodycam video of Daniel Auderer, who is Vice President of the Seattle Police Officers Guild, has gone

Johns Hopkins Postdoctoral Association (JHPDA) (@jhpda) 's Twitter Profile Photo

What is Brooklyn plot? They are a new tool to detect global changes in genomically-related adjacent gene co-expression within single cell RNA sequencing (scRNA-seq) data Great tool provided by Arun Marc Halushka MD PhD academic.oup.com/nargab/article…

What is Brooklyn plot?
They are a new tool to detect global changes in genomically-related adjacent gene co-expression within single cell RNA sequencing (scRNA-seq) data
Great tool provided by <a href="/arun26feb/">Arun</a> <a href="/Marc_Halushka/">Marc Halushka MD PhD</a> 
academic.oup.com/nargab/article…