Check out our pre-print! No more "activated microglia" please😆🤪. I mean it. And no more "M1/M2" nonsense either☠☠☠. Defining Microglial States and Nomenclature: A Roadmap to 2030 SSRN @cellpressnews Sneak Peek papers.ssrn.com/sol3/papers.cf…

Neutrophils guide pre-existing matrix into injured organs to initiate tissue repair. News and Views by Ng. go.nature.com/3uFflKO

Such a charming way to describe the philosophy the scientific process. Finding that balance between "night vs. day" science (i.e exploration vs. hypothesis testing) is all the more important with the increasing size and complexity of data sets!

Imagine a human cell or DNA molecule painted by Salvador Dali. Perhaps the paintings would look like these. Thanks to Artificial Intelligence (a program called DALL-E) we were able to create these images. Isn't it very cool?

If I look by gender, there's a really striking difference: our entering class was 48% women, but all 6 of the people who are currently PI's are male.

#zebrafish #cancer #singlecell #liveimaging all in one project! I have a PhD project in MRC precision medicine DTP virtual Q&A session 9th Dec 10am ed.ac.uk/usher/precisio…

Great advice for how to ask questions following talks/seminars! Will be sharing this with the students in my group.

Ooo!

RT for my own future reference!

ATGGAGAGGAGGTACTGCCACAGGATCAGCACCATGGCCAGCGCCAACGACGCCCACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG from everyone at Ensembl

Biggest paper yet from the lab out now in Immunity! It is a massive #openscience resource on #tissueTregs, and what makes #Tregs tick in the #tissues. Spoiler-alert: Tissue Tregs are really different from what we all thought. 🧵 1/21 sciencedirect.com/science/articl…