DRESDEN-concept Genome Center (@dcgenomecenter) 's Twitter Profile
DRESDEN-concept Genome Center

@dcgenomecenter

+ + + not actively maintained anymore+++

DRESDEN-concept Genome Center (DcGC)
Joint NGS technology center
Part of the German NGS Competence Network

ID: 1367490650409680901

linkhttps://genomecenter.tu-dresden.de calendar_today04-03-2021 15:04:23

145 Tweet

249 Followers

45 Following

DRESDEN-concept Genome Center (@dcgenomecenter) 's Twitter Profile Photo

If you are interested in #biodiversity and #genomics, one or the other, or even wondering how they come together... make sure to watch this seminar: *proudly sponsored by the @NGSCN1 šŸ˜‰

The German Human Genome-Phenome Archive (@ghga_de) 's Twitter Profile Photo

Become part of the #GHGAsquad at Universität Tübingen! We are looking for a scientific project manager at our data hub in Tübingen, supporting our central project management team and training efforts! More at ghga.de/about-us/jobs

Become part of the #GHGAsquad at <a href="/uni_tue/">Universität Tübingen</a>! 

We are looking for a scientific project manager at our data hub in Tübingen, supporting our central project management team and training efforts!

More at ghga.de/about-us/jobs
DRESDEN-concept Genome Center (@dcgenomecenter) 's Twitter Profile Photo

Our #LIMS system got a major backend improvement, thanks to the magic brains & hands of our IT experts! At the frontend, the main diff. to users is the new name, Rosalind, our team's tribute to #RosalindFranklin, one of the greatest #womeninscience and role model to many us.

West German Genome Center (@wggc_de) 's Twitter Profile Photo

šŸŽ§ All sketches for the released Explain Podcast episodes can be found on our Insta Dictionary.pod You're welcome! instagram.com/explain.pod Choose the platform to listen to a podcast - Spotify supports chapters! ngs-kn.de/explain-podcas…

šŸŽ§ All sketches for the released Explain Podcast episodes can be found on our Insta <a href="/explain/">Dictionary</a>.pod 

You're welcome! instagram.com/explain.pod

Choose the platform to listen to a podcast - Spotify supports chapters!
ngs-kn.de/explain-podcas…
DRESDEN-concept Genome Center (@dcgenomecenter) 's Twitter Profile Photo

CACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG! Our team wishes you a wonderful and successful 2024! We are looking forward to many exciting new projects and collaborations :))) #frohesneues

DRESDEN-concept Genome Center (@dcgenomecenter) 's Twitter Profile Photo

DcGC will no longer be posting on this platform. Account remains as an archive. We'll be further communicating our news on: - Website genomecenter.tu-dresden.de - LinkedIn linkedin.com/company/dresde…