Summary by @bonita_powell of “Pairing to the #miRNA 3′ region occurs through two alternative binding modes w/affinity shaped by nucleotide identity & pairing position” from the Bartel lab biorxiv.org/content/10.110… Marc Halushka MD PhD LabWitwer #MeffertLab BCMB Graduate Program at JHMI #miRNAJournalClub

Want to know if your favorite microRNA is expressed in the cells you investigate? We've got 196 answers for you! "A curated human cellular microRNAome based on 196 primary cell types" biorxiv.org/content/10.110… Congrats to Arun, Matthew N. McCall, Zach Brehm and Andrea Baran.

Best biological reagent ever obtained in the Halushka laboratory. USBiological salsa. I kid you not. Enjoyed it at our lab meeting yesterday and it was DELICIOUS!

Science leaders demand crackdown on medical research fraudsters after allegations that pivotal Alzheimer's study contained manipulated data - giving false hope to families and slowing the development of effective treatments Barney Calman @ Mail on Sunday dailymail.co.uk/health/article…

Anyone in the #tunicate, #ciona, tunicate, sea squirt community know what this dense matrix material is in the wall of a Ciona Robusta? Muscle cells at bottom in H&E for size reference.

Thank you Marc Halushka MD PhD, Matthew N. McCall and McCall lab 😀

Day 110 : Pdf To Audio using Python youtu.be/cYW-VHTLqGs

Beware of fare hard drives (HDD/SSD) on #AmazonPrimeDay #amazon and similar providers. Especially new brands and “made in China”.

I wish this comes in US (affordable price though😬), I would personally install it in my apartment.

Many thanks to Marc Halushka MD PhD @BastianFromm and Retraction Watch our concerns regarding novel #mirna is out and hopefully it helps the scientific/medical field.

High impact journals doesn’t always mean quality research. Our journey/experience of such concerns is shared. ⁦Retraction Watch⁩ retractionwatch.com/2022/10/22/wee…

~~ANNOUNCING the HALUSHKA-X PRIZE~~ $100 Amazon Gift Card to the first person to identify the sequence "TCTTGCAATTAAAAGGGGGAA" in human RNA-seq data. Details of the competition here: tinyurl.com/5n6z5wsx.

Behold one of the mightiest tools in mathematics: the camel principle. I am dead serious. Deep down, this tiny rule is the cog in many methods. Ones that you use every day. Here is what it is, how it works, and why it is essential.

I don’t usually post personal news but Clinicians have told us to pull every lever. Our daughter has with #dipg Brain cancer. There is no cure and typically 9m life expectancy. If anyone knows of trials then please get in contact! #braincancer #childrenscancer Cancer Research UK

An Indian student Jaahnavi Kandula from Andhra Pradesh was studying in USA. She was killed in a road accident by a Police car in January 2023. Now, 8 months after accident, a bodycam video of Daniel Auderer, who is Vice President of the Seattle Police Officers Guild, has gone

What is Brooklyn plot? They are a new tool to detect global changes in genomically-related adjacent gene co-expression within single cell RNA sequencing (scRNA-seq) data Great tool provided by Arun Marc Halushka MD PhD academic.oup.com/nargab/article…

Thank you😃 Matthew N. McCall and Marc Halushka MD PhD

Congratulations Tim O. Nieuwenhuis