UpTop.meme (@uptopmeme) 's Twitter Profile
UpTop.meme

@uptopmeme

UpTop is a Web3 Build-to-Earn competition platform combining dynamic auctions, high-frequency draws, and ultimate jackpot rewards.

ID: 1775756642228768768

linkhttp://UpTop.meme calendar_today04-04-2024 05:26:08

102 Tweet

307,307K Takipçi

196 Takip Edilen

UpTop.meme (@uptopmeme) 's Twitter Profile Photo

Continuing to build for BNBChain and working hard to help users earn more LP rewards! Thank you BNB Chain BNB Chain 華語 and Four.Meme for your support UpTop is on its way to the top!

UpTop.meme (@uptopmeme) 's Twitter Profile Photo

We are excited to announce that the outstanding Four.meme project $TST is officially launching on UpTop! Starting from June 2, UpTop will open high-yield liquidity pool slots for TST/BNB, offering liquidity providers the following triple rewards: 1. Base APR of

We are excited to announce that the outstanding Four.meme project $TST  is officially launching on UpTop!

Starting from June 2, UpTop will open high-yield liquidity pool slots for TST/BNB, offering liquidity providers the following triple rewards:
 1. Base APR of
Four.Meme (@four_meme_) 's Twitter Profile Photo

🚀 UpTop is leveling up liquidity farming — launching high-yield $TST/BNB LP slots on June 2! Test Token Liquidity providers get triple rewards: 🔸 35% base APR (subsidized by Four.Meme) 🔸 35% TGE airdrop bonus 🔸 ~33% PancakeSwap fee sharing UpTop x

UpTop.meme (@uptopmeme) 's Twitter Profile Photo

Congratulations to our dear partner Four.Meme , and welcome WLFI for providing incentive rewards to support liquidity on BNB Chain . Huge thanks to all the users who contributed to the BNB/USD1 liquidity pool through #UpTop!

UpTop.meme (@uptopmeme) 's Twitter Profile Photo

This DNA sequence could potentially be embedded in the human genome. “CTCCCTAACTCACGTTCTAATGCGGCCAGTGCTGCCGATTGCGATGCGGCTAGGGGTGCGGCTCGGCCTGTTGTTAGATATGCCGTGTGTGGTGGAGGTGGTTGCGAGCGTGCGAGCGATCGGACGACCGGCCGTGTGTTGTTAGAAC”

Ansem (@blknoiz06) 's Twitter Profile Photo

not as tapped in w/ eastern CT but seems like they have their own adjacent pump.fun ecosystem w/ Four.Meme is CZ pumping any of the memes over there on BNB

UpTop.meme (@uptopmeme) 's Twitter Profile Photo

⚠️ Beware of fake UpTop tokens! ⚠️ We have already identified hundreds of fake UpTop tokens circulating externally. These are not affiliated with us and may pose scam or phishing risks. Please only trust information from our official Twitter: UpTop.meme Do not click on

UpTop.meme (@uptopmeme) 's Twitter Profile Photo

If you were part of the Uptop team, which platform would you partner with for the TGE, and what TGE model would you go for? #uptop #TGE