Michael McCarty (@mkmccarty3) 's Twitter Profile
Michael McCarty

@mkmccarty3

Builder & Engineer | Co. Acquired 2022 | CPO

ID: 1036111597918281728

calendar_today02-09-2018 04:40:29

1,1K Tweet

954 Takipçi

825 Takip Edilen

Anthony Pompliano 🌪 (@apompliano) 's Twitter Profile Photo

Putting bitcoin in your retirement account is one of the best ways to ensure long-term thinking, while significantly reducing your tax bill. Chris Kline (Chris Kline) runs a company that is empowering people to do exactly this, so we sat down to discuss how it works, what

Niko McCarty 🧫 (@nikomccarty) 's Twitter Profile Photo

Just now: Arc Institute and NVIDIA release Evo 2, the largest AI model for biology. It is fully open-source. Evo 2 can predict which mutations in a gene are likely to be pathogenic, or even design entire eukaryotic genomes. We covered it in Asimov Press! Check it out 🔻

Just now: <a href="/arcinstitute/">Arc Institute</a> and <a href="/nvidia/">NVIDIA</a> release Evo 2, the largest AI model for biology. It is fully open-source.

Evo 2 can predict which mutations in a gene are likely to be pathogenic, or even design entire eukaryotic genomes.

We covered it in <a href="/AsimovPress/">Asimov Press</a>! Check it out 🔻
Xander Balwit (@alexandrabalwit) 's Twitter Profile Photo

Issue 6 of Asimov Press incoming! It is a whopper of an issue with beautiful illustrations and incredible pieces — a powerful memoir, sci-fi, a killer book review, and more great biotech. You can get a preview here and read about some exciting updates!

Niko McCarty 🧫 (@nikomccarty) 's Twitter Profile Photo

We are profoundly grateful to Jennifer for sharing her story with us. I first met with her in Cambridge, many months ago. Writing this story was a deep (and painful) labor of love. Hopefully this story will be helpful to other women navigating IVF and embryo screening.

Niko McCarty 🧫 (@nikomccarty) 's Twitter Profile Photo

Some final photos of the new Asimov Press book for today... The book has lots of nice images & the stickers turned out great. Also, none of this would have been possible without financial support from Asimov, Astera Institute, and Stripe. Thank you!

Some final photos of the new <a href="/AsimovPress/">Asimov Press</a> book for today...

The book has lots of nice images &amp; the stickers turned out great.

Also, none of this would have been possible without financial support from <a href="/AsimovBio/">Asimov</a>, <a href="/AsteraInstitute/">Astera Institute</a>, and <a href="/stripe/">Stripe</a>. Thank you!
Niko McCarty 🧫 (@nikomccarty) 's Twitter Profile Photo

Asimov Press. Book Unboxing. Encoded in English and DNA. Designed by Everything Studio | Brooklyn, NY Printed by Shapco | Minneapolis, MN Published by Asimov Press | San Francisco, CA CATGATGACAGCTAGCGTCTAAGCCATTGTTGTTCGACG

Stephen Malina (@an1lam) 's Twitter Profile Photo

Even having prepared myself for how cool the Asimov Press DNA + book pair would be, it exceeded my expectations. Thank you! (Obviously to continue raising the bar, the next book will have to come with a synthetic organism.)

Even having prepared myself for how cool the <a href="/AsimovPress/">Asimov Press</a> DNA + book pair would be, it exceeded my expectations. Thank you! 

(Obviously to continue raising the bar, the next book will have to come with a synthetic organism.)
Niko McCarty 🧫 (@nikomccarty) 's Twitter Profile Photo

A single E. coli is 70 percent water. The other 30 percent is mostly proteins. A single type, called Lpp, accounts for ~1/3 of all proteins in a cell. It takes less energy to build a cell than it takes to lift an apple from the ground to a height of one meter. New post by me🔻

A single E. coli is 70 percent water. The other 30 percent is mostly proteins. A single type, called Lpp, accounts for ~1/3 of all proteins in a cell.

It takes less energy to build a cell than it takes to lift an apple from the ground to a height of one meter.

New post by me🔻
Tom Ellis (@proftomellis) 's Twitter Profile Photo

My first DNA-encoded book. Just landed in a London. Love it! Tempted to smash it open and shotgun clone it into yeast cells to see which parts of the book help yeast grow quicker. Thanks Niko McCarty. and everyone at Asimov Press Alec Nielsen

My first DNA-encoded book. Just landed in a London. Love it! Tempted to smash it open and shotgun clone it into yeast cells to see which parts of the book help yeast grow quicker. Thanks <a href="/NikoMcCarty/">Niko McCarty.</a> and everyone at <a href="/AsimovPress/">Asimov Press</a> <a href="/alectricity/">Alec Nielsen</a>
Amritpal Singh, PhD (@synghbio) 's Twitter Profile Photo

Can’t wait to read this over the Easter break! Brilliant work Niko McCarty 🧫 Asimov Press , the sheer quality of the book and its presentation is top notch, you’ve pulled out all the stops! Is it strange that the minute we get our hands on some DNA we want to send it fr sequencing?

Can’t wait to read this over the Easter break! Brilliant work <a href="/NikoMcCarty/">Niko McCarty 🧫</a> <a href="/AsimovPress/">Asimov Press</a> , the sheer quality of the book and its presentation is top notch, you’ve pulled out all the stops! Is it strange that the minute we get our hands on some DNA we want to send it fr sequencing?
Ben Putano 📚 (@benjaminputano) 's Twitter Profile Photo

A book... written on DNA?! One of the most fascinating things in my collection. An anthology of essays on DNA and bio-tech, synthesized into thousands of strands of DNA and encapsulated. Well done @asimovpress @catalogtechnic @nikomccarty My next quest: understanding the the

A book... written on DNA?!

One of the most fascinating things in my collection. An anthology of essays on DNA and bio-tech, synthesized into thousands of strands of DNA and encapsulated. 

Well done @asimovpress @catalogtechnic @nikomccarty

My next quest: understanding the the
Niko McCarty 🧫 (@nikomccarty) 's Twitter Profile Photo

I'll be living near Stanford this summer, from ~June 10 to August 10. I'm hoping to meet lots of people and learn a lot more about AI+Bio efforts. Let's hang out!

I'll be living near Stanford this summer, from ~June 10 to August 10.

I'm hoping to meet lots of people and learn a lot more about AI+Bio efforts.

Let's hang out!
Rostra (@rostra_ai) 's Twitter Profile Photo

Rostra is an AI-powered tool that reduces hallucinations, bias, and policy breaches before they reach users. We connect with 24 top-performing AI models to spot errors in real-time, and our tools work with your company's workflow. Get in touch: rostra.ai

Rostra is an AI-powered tool that reduces hallucinations, bias, and policy breaches before they reach users.

We connect with 24 top-performing AI models to spot errors in real-time, and our tools work with your company's workflow.

Get in touch: rostra.ai
Rostra (@rostra_ai) 's Twitter Profile Photo

We benchmarked the factual accuracy of Rostra against leading AI models, including GPT-4.1 and Claude 3.5, on 250 random Jeopardy! questions. Rostra outperformed all other models, with an error rate of 4.2 percent. GPT-4.1 error rate of 6.7%; Claude 3.5 Haiku error rate > 16%.

We benchmarked the factual accuracy of Rostra against leading AI models, including GPT-4.1 and Claude 3.5, on 250 random Jeopardy! questions.

Rostra outperformed all other models, with an error rate of 4.2 percent. GPT-4.1 error rate of 6.7%; Claude 3.5 Haiku error rate &gt; 16%.
Rostra (@rostra_ai) 's Twitter Profile Photo

Every AI model makes mistakes. But rather than trusting answers from a single AI model, our Best Answers tool collects opinions from a quorum of models and then returns only what multiple engines—and internal or external evidence—confirm to be true. NEW BLOG POST 🔻

Every AI model makes mistakes.

But rather than trusting answers from a single AI model, our Best Answers tool collects opinions from a quorum of models and then returns only what multiple engines—and internal or external evidence—confirm to be true.

NEW BLOG POST 🔻
Rostra (@rostra_ai) 's Twitter Profile Photo

We’re building a no-code “clearinghouse” for AI models. You can run a prompt across multiple models at once and then compare their outputs side-by-side, or send prompts to individual models. We currently integrate with 25 leading AI models, so you only need one subscription.

We’re building a no-code “clearinghouse” for AI models.

You can run a prompt across multiple models at once and then compare their outputs side-by-side, or send prompts to individual models.

We currently integrate with 25 leading AI models, so you only need one subscription.
minibase.ai (@minibase_ai) 's Twitter Profile Photo

Language vision models underwhelm at science tasks. A new benchmark, MaCBench, evaluated models on data extraction, experiment execution & data interpretation. Claude 3.5 Sonnet did best, but accuracies were generally low across the board. New Blog: blog.minibase.ai/p/language-vis…