Albert Escobedo (@albertiltirda) 's Twitter Profile
Albert Escobedo

@albertiltirda

Postdoc @ the CRG Genetic Systems lab | Protein biophysics - Deep Mutational Scanning - NMR - Molecular Dynamics

ID: 387653293

calendar_today09-10-2011 12:50:40

125 Tweet

214 Takipçi

874 Takip Edilen

ALLOX (@alloxbio) 's Twitter Profile Photo

🧪 Are you passionate about molecular cloning? 🧬 Are you interested in applying ingenious methods for generating mutant libraries? 💊 Are you excited to join an exceptional team of scientists committed to revolutionising drug discovery? If so, here is a new job opportunity 👇

Manuel Ansede (@manuelansede) 's Twitter Profile Photo

GCAAGGACATATGGGCGAAGGAGA, las 24 letras cruciales en el surgimiento del autismo. Científicos del IRB Barcelona han descubierto un mecanismo que podría explicar un elevado porcentaje de los trastornos del espectro autista: elpais.com/ciencia/2024-1…

Albert Escobedo (@albertiltirda) 's Twitter Profile Photo

I am incredibly excited to announce that our project with Ben Lehner, Thomas Wilhelm, and the Centre for Genomic Regulation (CRG) #TBDO has been awarded a Proof of Concept Grant from European Research Council (ERC)! Huge thanks to everyone involved for their ongoing support – let's boost the science!

Albert Escobedo (@albertiltirda) 's Twitter Profile Photo

Thank you Benedetta Bolognesi Mafalda Dias Jonathan Frazer for inviting me to share how we fit thermodynamic models to DMS data at this 8th MSS workshop 🙏🏼! It’s been a pleasure to share the floor with Noelia Ferruz and Pascal Notin and learn lots from them 👨🏻‍💻!

Albert Escobedo (@albertiltirda) 's Twitter Profile Photo

🤯 Mapping energy couplings in the Aβ42 nucleation transition state? 💪🏼 No problem for crack team Anna Arutyunyan Mseu Andre Faure @ajfaure.bsky.social Ben Lehner & Benedetta Bolognesi! 🧠 A massive tour-de-force in Alzheimer’s & neurodegeneration research — 📄 check out the paper and Anna’s awesome thread!