Francesco Monaca (@monaca97) 's Twitter Profile
Francesco Monaca

@monaca97

vc @earlybirdvc | 🩶 deeptech | 🧠 neuro phd @thecrick, @ucl

ID: 2310416351

linkhttps://www.linkedin.com/in/monacafrancesco/ calendar_today28-01-2014 19:27:29

169 Tweet

199 Takipçi

861 Takip Edilen

Ensembl (@ensembl) 's Twitter Profile Photo

ATGGAGAGGAGGTACTGCCACAGGATCAGCACCATGGCCAGCGCCAACGACGCCCACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG from everyone at Ensembl! buff.ly/1Izo5qL

Neuron (@neurocellpress) 's Twitter Profile Photo

Anderson lab Caltech characterizes threat displays in flies and the sensory cues required for this behavior cell.com/neuron/fulltex… Preview by Gordon Berman cell.com/neuron/fulltex…

Francesco Monaca (@monaca97) 's Twitter Profile Photo

“The trouble is philosophers love to define things, and then live or die by the definitions they’ve endorsed. People end up talking past each other, or proving things about irrelevant artificial divisions of the world. [...] Definitions are overrated.”

Moheb Costandi (@mocost) 's Twitter Profile Photo

Architecture and subunit arrangement of native AMPA receptors elucidated by cryo-EM science.sciencemag.org/content/early/…

Architecture and subunit arrangement of native AMPA receptors elucidated by cryo-EM science.sciencemag.org/content/early/…
Nature Portfolio (@natureportfolio) 's Twitter Profile Photo

Dopamine signalling is important in a number of processes but how it can support them all is unclear. A paper in Nature shows that dopamine release and cell firing may have different functions during reward-related learning. go.nature.com/2HypoK4

Dopamine signalling is important in a number of processes but how it can support them all is unclear. A paper in Nature shows that dopamine release and cell firing may have different functions during reward-related learning. go.nature.com/2HypoK4
Katrin Franke (@kfrankelab) 's Twitter Profile Photo

Do you agree that animal research is essential in #Biology & #MedicalResearch? 📢The EU will be discussing a complete ban of animal research - Please support this initiative pro animal research in Europe & spread the word 🙏 braincouncil.eu/pledge-for-sci…

Francesco Monaca (@monaca97) 's Twitter Profile Photo

Crick Science Entrepreneur Network (CSEN)⁩ x ⁦NeuroTechX⁩ are hosting a NeuroTech Spotlight ✨🧠✨ event at ⁦The Francis Crick Institute⁩, discussing all things neuroscience x technology! (Incredible guests, exciting startups, and obviously drinks 🥂) Join us (2nd Feb) ➡️ lu.ma/6mgm7mu0

Francesco Monaca (@monaca97) 's Twitter Profile Photo

*Potentially* exciting development from neuro research: BullFrogAI partners with the Lieber Institute, the world’s largest collection of human brain samples, uncovering (unprecedented) AI-led insights at gene level into neuropsychiatric conditions ⏬ ir.bullfrogai.com/news-events/pr…

Dr. Shelby (@shelbynewsad) 's Twitter Profile Photo

Autonomous Science enables entirely *new types* of discovery and economics. We've concluded edge cases - prion research, high-risk pathogen research, geoengineering - and autonomous CRO's - optimization and scale-up - are the best place to start company building. In order to

Autonomous Science enables entirely *new types* of discovery and economics. 

We've concluded edge cases - prion research, high-risk pathogen research, geoengineering - and autonomous CRO's - optimization and scale-up - are the best place to start company building. 

In order to
Asimov Press (@asimovpress) 's Twitter Profile Photo

Today, a landmark study from Institute for Protein Design announced its progress toward creating AI-designed enzymes. owl and eryney marrogi explain how their method provides a roadmap for creating other types of dynamic, moving proteins. Read here: asimov.press/p/ai-enzymes

Arc Institute (@arcinstitute) 's Twitter Profile Photo

Announcing Evo 2: The largest publicly available, AI model for biology to date, capable of understanding and designing genetic code across all three domains of life. arcinstitute.org/manuscripts/Ev…

Announcing Evo 2: The largest publicly available, AI model for biology to date, capable of understanding and designing genetic code across all three domains of life. arcinstitute.org/manuscripts/Ev…