My latest short story is called "Lena". qntm.org/mmacevedo

Congratulations to Felix Lansing Liliya Mukhametzyanova @teresa__rojo and contributors for all of the hard work gone into the Nature Communications publication! A detailed look into the development and application of designer-recombinases for correcting genomic inversions.

Congrats to Jenna Hoersten from Buchholz Lab for her #UpgradeH2020 publication in @NAR_Open. The authors report a new system to make catalytically obligate site-specific #recombinases, improving recombination specificity in human cells. Read more here: ncbi.nlm.nih.gov/pmc/articles/P…

AATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAGAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAAAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTGA

Our paper on a versatile, automated, and high throughput end-to-end platform for plasmid construction has just been published (nature.com/articles/s4146…). This PlasmidMaker tool should be highly useful for basic and applied biology research. Congrats to the whole team!

🥳 So happy to announce my main PhD work is now out in Cancer Research!🥳 Efficient Correction of Oncogenic KRAS and TP53 Mutations through CRISPR Base Editing aacrjournals.org/cancerres/arti… Big thank you to everyone involved Buchholz Lab @Medizin_TUD Nationales Centrum für Tumorerkrankungen Dresden Science 🧵 below

Congratulations @_CamiloRG and @TatiSandGuz lab!

Had great fun presenting my paper for the first time at the 21st AEK Cancer Congress. Such an honor to be selected to present my work and to receive the Young Investigator Award. Thanks to the organisers for putting together this amazing meeting!!!🔬🥳🥳 #AEK2023

🎉I am thrilled to announce that my PhD thesis work got published in Nature Biotechnology today! Grateful to all co-authors from Buchholz Lab and @seamlesstx.🧬We developed zinc finger DNA-binding dependent site-specific recombinases. nature.com/articles/s4158… See the thread below:

Check out our back-to-back papers in Nature Communications today! 1st paper describes development of 16 orthogonal LoxPSym sites for easier genetic engineering - rdcu.be/dx2Yr. 2nd paper shows use in promoter shuffling for metabolic pathway optimization rdcu.be/dx20C

Today we report in Nature Biomedical Engineering the eePASSIGE system, which uses evolved and engineered recombinases and prime editing to integrate large gene-sized DNA cargoes into the mammalian genome in an efficient, precise, and targeted manner. (1/13) drive.google.com/file/d/1WDMVqL…

Spreading the word about all things DNA at the Dresdener Lange Nacht der Wissenschaften! 🧬🪄 #LNDWDD #GeneTherapie CRTD TU Dresden @Medizin_TUD

🧵In new work, we report a systematic engineering roadmap to optimize large serine recombinases (LSRs) for direct, site-specific insertion into the human genome 🧬. We achieved over 50% insertion efficiency and 97% genome-wide specificity, a 10X improvement over our previous work