me being an amazing supportive and dependable friend for demelly

uagagaaaagauahahhhhhhhhhhh #bnha

mane six 🍺🐺 #MLP

thanks for coming to stream!

uuagagauauugagauauuaagauaugaagagag #bnha

may we all get to see a free Palestine next Eid.

wintersberg #ethanwinters #karlheisenberg #wintersberg #REBHFun

growing rosemary🏳️‍⚧️ #ethanwinters #miawinters #mithan

mushroom #ethanwinters #miawinters #mithan

theres no ethan content and i realized its because i havent posted anything in like 2 days

kamisero yyeeyyy....

more frames for my resident evil animation

Scuffed resident company doodles slowly crawls away from art block
#lethanfield #wintersberg #ResidentEvil

working on a new animation! currently on the sequence of ethans life

#ethanwinters